Journal: PLoS ONE

Article Title: Development of Lymphoproliferative Diseases by Hypoxia Inducible Factor-1alpha Is Associated with Prolonged Lymphocyte Survival

doi: 10.1371/journal.pone.0057833

Figure Lengend Snippet: (A) The construct of chimeric gene including human HIF1A cDNA fused with the FLAG gene at the 5′ end of the HIF1A gene. (B) Activation of human HIF-1alpha protein in murine cells was confirmed by luciferase activity in BALB/3T3 cells stably transfected with the transgenic construct. (C) Ectopic expression of human HIF1A mRNA was determined by real-time RT-PCR as described in . (D) Sequential analyses of expression levels by real-time RT-PCR in various tissues of transgenic mice. Relative expression of human HIF1A mRNA was assessed by the level of Actb mRNA. (E) Expression of HIF-1alpha protein in various organs was determined by western blotting with use of both anti-HIF-1alpha and anti-FLAG antibodies.

Article Snippet: PCR reaction proceeded at fast mode: 95°C for 20 sec followed by 40 cycles at 95°C for 1 sec and 60°C for 20 sec. Primer sets were as follows: human HIF1A (Hs00153153), and Actb (Mm00607939) (TaqMan® Gene Expression Assays, Inventoried).

Techniques: Construct, Activation Assay, Luciferase, Activity Assay, Stable Transfection, Transfection, Transgenic Assay, Expressing, Quantitative RT-PCR, Western Blot

Journal: PLoS ONE

Article Title: Development of Lymphoproliferative Diseases by Hypoxia Inducible Factor-1alpha Is Associated with Prolonged Lymphocyte Survival

doi: 10.1371/journal.pone.0057833

Figure Lengend Snippet: The number of enlarged Peyer's patches per mouse (size greater than 3 mm, determined by Methylene Blue staining) increased in both the small intestine (A) and colon (B) of HIF1A TG mice, compared with that found in wild-type or BALB/c mice (p<0.01 and 0.05, respectively).

Article Snippet: PCR reaction proceeded at fast mode: 95°C for 20 sec followed by 40 cycles at 95°C for 1 sec and 60°C for 20 sec. Primer sets were as follows: human HIF1A (Hs00153153), and Actb (Mm00607939) (TaqMan® Gene Expression Assays, Inventoried).

Techniques: Staining

Journal: PLoS ONE

Article Title: Development of Lymphoproliferative Diseases by Hypoxia Inducible Factor-1alpha Is Associated with Prolonged Lymphocyte Survival

doi: 10.1371/journal.pone.0057833

Figure Lengend Snippet: Overall survival of HIF1A TG heterozygous mice was shorter than that of wild-type mice in 24-month follow-up (p<0.05).

Article Snippet: PCR reaction proceeded at fast mode: 95°C for 20 sec followed by 40 cycles at 95°C for 1 sec and 60°C for 20 sec. Primer sets were as follows: human HIF1A (Hs00153153), and Actb (Mm00607939) (TaqMan® Gene Expression Assays, Inventoried).

Techniques:

Journal: PLoS ONE

Article Title: Development of Lymphoproliferative Diseases by Hypoxia Inducible Factor-1alpha Is Associated with Prolonged Lymphocyte Survival

doi: 10.1371/journal.pone.0057833

Figure Lengend Snippet: Proliferation rates were determined for splenic B cells from HIF1A TG and wild-type mice in terms of BrdU incorporation indices, although no clear differences were found between them. Proliferation rates of splenic B cells stimulated by LPS or IgM (A), splenic T cells stimulated by TPA and ionomycine (B), thymocytes stimulated by TPA and ionomycine (C), or B cells from Peyer's patchs stimulated by LPS (D).

Article Snippet: PCR reaction proceeded at fast mode: 95°C for 20 sec followed by 40 cycles at 95°C for 1 sec and 60°C for 20 sec. Primer sets were as follows: human HIF1A (Hs00153153), and Actb (Mm00607939) (TaqMan® Gene Expression Assays, Inventoried).

Techniques: BrdU Incorporation Assay

Journal: PLoS ONE

Article Title: Development of Lymphoproliferative Diseases by Hypoxia Inducible Factor-1alpha Is Associated with Prolonged Lymphocyte Survival

doi: 10.1371/journal.pone.0057833

Figure Lengend Snippet: Splenic lymphocytes were cultured under non-stimulating conditions for 28 days. Survival rates of splenic B cells (A) and splenic T cells (B). The declining slope was remarkably lower in HIF1A TG mice than in wild-type mice. (C, D) The sensitivity of HIF1A TG mice lymphocytes to etoposide, a topoisomerase II inhibitor.

Article Snippet: PCR reaction proceeded at fast mode: 95°C for 20 sec followed by 40 cycles at 95°C for 1 sec and 60°C for 20 sec. Primer sets were as follows: human HIF1A (Hs00153153), and Actb (Mm00607939) (TaqMan® Gene Expression Assays, Inventoried).

Techniques: Cell Culture

Journal: bioRxiv

Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia

doi: 10.1101/2021.02.02.429407

Figure Lengend Snippet: (a) Immunoblot analysis of HIF1A and ARNT proteins in the indicated MIA PaCa-2 HIF1A and ARNT knockout cell lines treated with the prolyl-hydroxylase (PHD)-inhibitor FG-4592 (100 μM, 72 hrs) as shown. Vinculin was used as a loading control. FG-4592 is used to stabilize HIFs and confirm pathway disruption. (b) Relative mRNA levels of HIF1A-target lactate dehydrogenase A (LDHA) mRNA expression in the indicated MIA PaCa-2 knockout cells treated with FG-4592 (100 μM for 72 hrs) compared to untreated cells. (c, d) Representative images ( c ) and quantification ( d ) of TMR-dextran (red) uptake in the indicated MIA PaCa-2 knockout cell lines under normoxia (21% O) or hypoxia (0.5% O 2 ). Nuclei are labeled with DAPI (blue). Scale bar, 10 μm. In d , data are presented relative to values obtained for normoxic control cells. (e) Immunoblot analysis of HIF1A in MIA PaCa-2 cells expressing a constitutively stable HIF1A isoform (HA-HIF1A P402/P564A) cDNA. Vinculin was used as a loading control. (f, g) Representative images ( f ) and quantification ( g ) of TMR-dextran (red) uptake in MIA PaCa-2 cells transduced with vector control or HA-HIF1A P402/P564A cDNA under normoxia (21% O 2 ) or hypoxia (0.5% O 2 ). In g , data are presented relative to normoxia cells transduced with a control vector. (h) Quantification of macropinocytic uptake from sections of xenograft tumors derived from MIA PaCa-2 cells transduced with a control sgRNA or sgRNAs targeting HIF1A or ARNT showing tumor macropinocytic index in hypoxic tumor areas (CK8+/Pimo+, red) and non-hypoxic tumor areas (CK8+/Pimo-, grey). Data is presented relative to non-hypoxic areas in tumors arising from cells transduced with a control sgRNA. (i) Representative images from sections of xenograft tumors derived from MIA PaCa-2 cells expressing HA-HIF1A P402/P564A cDNA showing macropinosomes labeled with TMR-dextran (red), tumor cells immunostained with anti-CK8 (green), and pimonidazole detected with anti-pimonidazole (purple). Nuclei are labeled with DAPI (blue). Dashed lines indicate high (purple) and low (white) areas of pimonidazole staining. Scale bar = 50 μm. (j) Quantification of macropinocytic uptake in (i) showing tumor macropinocytic index in hypoxic tumor areas (CK8+/Pimo+, red) and non-hypoxic tumor areas (CK8+/Pimo-, grey). Data is presented relative to non-hypoxic areas in tumors derived from cells transduced with a control vector. b, d, g, Bars represent mean ± s.e.m.; h, j , At least 500 ( c, d, g ) or 300 ( h, j ) cells were quantified in each biological replicate ( n = 3). Statistical significance was determined by two-tailed unpaired t -test.

Article Snippet: Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) , and amplified by PCR using the following primers prior to its cloning into PMXS-IRES-Blast: HIF1A_cDNA_F, GCCGGATCTAGCTAGTTAATTAAGCCACCATGGCCTACCCCTACGACGTGCCCGACT; HIF1A_cDNA_R, GGGCGGAATTTACGTAGCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC.

Techniques: Western Blot, Knock-Out, Control, Disruption, Expressing, Labeling, Transduction, Plasmid Preparation, Derivative Assay, Staining, Two Tailed Test

Journal: bioRxiv

Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia

doi: 10.1101/2021.02.02.429407

Figure Lengend Snippet: (a) Immunoblot analysis of HIF1A and ARNT in the indicated sgRNA-transduced PANC-1 cells treated with FG-4592 as shown. Vinculin was used as a loading control. (b, c) Representative images ( b ) and quantification ( c ) of TMR-dextran (red) uptake in control or sgHIF1A- or sgARNT-transduced PANC-1 cells under normoxia (21% O 2 ) or hypoxia (0.5% O 2 ). Nuclei are labeled with DAPI (blue). Scale bar, 10 μm. In c , data are presented relative to values obtained for control normoxic cells. (d) Relative mRNA levels of the HIF1A-target lactate dehydrogenase A (LDHA) in the indicated MIA PaCa-2 cell lines expressing a control vector or HA-HIF1A P402/P564A cDNA and treated with the prolyl-hydroxylase (PHD)-inhibitor FG-4592 (100 μM, 72 hrs) as shown. (e, f) Representative images ( e ) and quantification ( f ) of TMR-dextran (red) uptake in PANC-1 cells expressing a control vector or HA-HIF1A P402/P564A cDNA under normoxia (21% O 2 ) or hypoxia (0.5% O 2 ). Nuclei are labeled with DAPI (blue). Scale bar, 10 μm. In f , data are presented relative to values obtained for control normoxic cells. (g) Immunoblot analysis of HIF1A in MIA PaCa-2 and BxPC-3 cells treated with 0, 100, and 500 μM of DMOG under normoxia (21% O 2 ). Vinculin was used as a loading control. (h) Representative images of TMR-dextran (red) uptake in MIA PaCa-2 cells in the absence or presence of DMOG (500 μM) under normoxia (21% O 2 ). Nuclei are labeled with DAPI (blue). Scale bar, 10 μm. (i) Quantification of macropinocytic uptake in MIA PaCa-2, PANC-1 and BxPC-3 cells treated in the absence or presence of DMOG (500 μM) under normoxia (21% O 2 ). Data are presented relative to values obtained for untreated cells. (j) Representative images of TMR-dextran (red) uptake from sections of xenograft tumors arising from MIA PaCa-2 cells transduced with sgRNAs targeting HIF1A or ARNT with tumor cells immunostained with anti-CK8 (green), and pimonidazole detected with anti-pimonidazole (purple). Nuclei are labeled with DAPI (blue). c, d, f, i, Bars represent mean ± s.e.m. At least 500 ( c, f, i ) cells were quantified in each biological replicate ( n = 3). Statistical significance was determined by two-tailed unpaired t -test.

Article Snippet: Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) , and amplified by PCR using the following primers prior to its cloning into PMXS-IRES-Blast: HIF1A_cDNA_F, GCCGGATCTAGCTAGTTAATTAAGCCACCATGGCCTACCCCTACGACGTGCCCGACT; HIF1A_cDNA_R, GGGCGGAATTTACGTAGCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC.

Techniques: Western Blot, Control, Labeling, Expressing, Plasmid Preparation, Transduction, Two Tailed Test

Journal: bioRxiv

Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia

doi: 10.1101/2021.02.02.429407

Figure Lengend Snippet: (a) Representative images of CA9 expression (red) from sections of MIA PaCa-2 xenograft tumor tissue with tumor cells immunostained with anti-CK8 (green), and pimonidazole detected with anti-pimonidazole (purple). Nuclei are labeled with DAPI (blue). (b) Immunofluorescence of CA9 relative to CK8 in sections of xenograft tumors arising from MIA PaCa-2 parental cells. Data are presented relative to values obtained for CK8+/pimo-areas. (c) Immunoblot analysis of CA9 and HIF1A in indicated cell lines expressing a control vector or HA-tagged HIF1A P402A/P564A cDNA. Vinculin was used as a loading control. (d) Immunoblot analysis of CA9 in the indicated cell lines transduced with a control sgRNA or an sgRNA targeting CA9. Vinculin was used as a loading control. (e, f) Representative images ( e ) and quantification ( f ) of TMR-dextran (red) uptake in control or sgCA9-transduced PANC-1 cells under normoxia (21% O 2 ) or hypoxia (0.5% O 2 ). Nuclei are labeled with DAPI (blue). Scale bar, 10 μm. In f , data are presented relative to values obtained for control cells under normoxia. (g) Immunoblot analysis of CA9 in MIA PaCa-2 and PANC-1 cells transduced with CA9 cDNA or a control vector. Vinculin was used as a loading control. (h) Representative images of TMR-dextran (red) uptake in control or CA9 overexpressing PANC-1 cells under normoxia (21% O 2 ) with macropinosomes labeled with TMR-dextran (red). Nuclei are labeled with DAPI (blue). (i) Quantification of TMR-dextran uptake in control or CA9 overexpressing PANC-1 cells under normoxia (21% O 2 ) and hypoxia (0.5% O 2 ). Data are presented relative to values obtained for control cells. (j) Quantification of TMR-dextran uptake in the indicated cell lines transfected with a control (-) or an SLC4A7 siRNA under normoxia (21% O 2 ) and hypoxia (0.5% O 2 ). Data are presented relative to values obtained for control normoxic cells. (k) Quantification of TMR-dextran uptake in MIA PaCa-2 cells treated with the PKA inhibitor H89 (15 μM) as shown under normoxia (21% O 2 ) or hypoxia (0.5% O 2 ). Data are presented relative to values obtained for control normoxic cells. b, f, i, j, k, Bars represent mean ± s.e.m. At least 300 ( b ) and 500 ( f, g, j, k, l ) cells were quantified in each biological replicate ( n = 3). Statistical significance was determined by two-tailed unpaired t -test.

Article Snippet: Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) , and amplified by PCR using the following primers prior to its cloning into PMXS-IRES-Blast: HIF1A_cDNA_F, GCCGGATCTAGCTAGTTAATTAAGCCACCATGGCCTACCCCTACGACGTGCCCGACT; HIF1A_cDNA_R, GGGCGGAATTTACGTAGCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC.

Techniques: Expressing, Labeling, Immunofluorescence, Western Blot, Control, Plasmid Preparation, Transduction, Transfection, Two Tailed Test

Journal: Cancer medicine

Article Title: Hypoxia and Hypoxia-Reoxygenation Potentiate Helicobacter pylori Infection and Gastric Epithelial Cell Proliferation.

doi: 10.1002/cam4.70860

Figure Lengend Snippet: FIGURE 1 | Hypoxia induces CEACAM6. Western blotting of whole cell lysates of AGS (a), MKN45 (b), and HFE145 (c) cells kept at normoxia or hypoxia (=H, 3% O2) showing levels of HIF1α and CEACAM6 at 6, 12, and 24 h. α-tubulin was used as loading control. Bar graphs indicated a significant increase in CEACAM6 level at 12-h time point. (d) A representative (n = 3) immunofluorescence micrograph showing elevated levels of HIF1α (green) and CEACAM6 (red) in AGS cells at 12 h of hypoxia (3% O2) exposure. Objective used = 40×, scale bar = 50 μm. (e) A representative (n = 3) immunofluorescence micrograph of human metastatic GC biopsy tissue sample showing the status of HIF1α (red) and CEACAM6 (green). Nuclei were stained for DAPI (blue). Tissues were sectioned at 5 μm thickness. Images were captured using 20× objective and scale bars = 50 μm. Graphs = mean ± SEM. Statistical significance was determined using two-way ANOVA followed by Tukey's post hoc analysis (n = 3). *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: Human CEACAM6- pdKCR- neo construct, pCMV6- Xl5- HIF1α (Origene Technologies, MD, USA), human NOX4 (courtesy: Karl- Heinz Krause, Addgene plasmid #69352) overexpression plasmids and empty vectors were used in this study [36, 37].

Techniques: Western Blot, Control, Immunofluorescence, Staining

Journal: Cancer medicine

Article Title: Hypoxia and Hypoxia-Reoxygenation Potentiate Helicobacter pylori Infection and Gastric Epithelial Cell Proliferation.

doi: 10.1002/cam4.70860

Figure Lengend Snippet: FIGURE 2 | HIF1α upregulates CEACAM6 in hypoxic GECs. (a) Knockdown of HIF1α decreased hypoxia-induced CEACAM6 protein level in AGS cells as detected by western blot. Whole cell lysates of HIF1α shRNA expressing as well as control shRNA-expressing stable AGS cells, kept under normoxic and hypoxic conditions for 12 h, showed decreased levels of HIF1α as well as CEACAM6. Bar graphs showed a significant reduction in CEACAM6:α-tubulin ratio in normoxia as well as hypoxia. (b) Representative micrographs showing CEACAM6 upregulation in HIF1α stably expressing AGS cells at 12 h hypoxia. The nuclei were stained with DAPI. Scale bar = 20 μm, =60×. Bar graph indicated significant changes in the mean fluorescence intensity. Hypoxia = 3% O2. All graphical data indicated mean ± SEM. Two-way ANOVA was applied to determine statistical sig- nificance, and the results were corrected for multiple comparisons using Tukey's post hoc analysis. n = 3, *p < 0.05; ****p < 0.0001.

Article Snippet: Human CEACAM6- pdKCR- neo construct, pCMV6- Xl5- HIF1α (Origene Technologies, MD, USA), human NOX4 (courtesy: Karl- Heinz Krause, Addgene plasmid #69352) overexpression plasmids and empty vectors were used in this study [36, 37].

Techniques: Knockdown, Western Blot, shRNA, Expressing, Control, Stable Transfection, Staining, Fluorescence

Journal: Cancer medicine

Article Title: Hypoxia and Hypoxia-Reoxygenation Potentiate Helicobacter pylori Infection and Gastric Epithelial Cell Proliferation.

doi: 10.1002/cam4.70860

Figure Lengend Snippet: FIGURE 3 | Hypoxia and HIF1α upregulate CEACAM6 and NOX4 in hypoxic GECs, gastritis as well as GC samples. (a) Immunofluorescence microscopy images showing enhanced ROS production in AGS cells under hypoxia. The mean fluorescence intensity (MFI) graph denoted the signif- icant difference in ROS generation between normoxia and hypoxia. Graphical data indicated mean ± SEM. Paired t-test was performed to determine statistical significance. n = 3, **p < 0.01. (b) Correlation analysis performed in GEPIA2 showed a positive Pearson correlation coefficient between HIF1α and NOX4 gene expression normalized to TUBA4A (p = 0, R = 0.64). (c) Box plot representation of NOX4 expression in STAD tumor and normal samples (red = tumor, gray = normal) showed a significant NOX4 upregulation in tumor samples (num[T] = 408, num[N] = 36, p value cutoff was 0.01). (d) Pathological stage plot showed a high association of NOX4 with the four stages of STAD tumor (F value = 5.67, Pr(>F) = 0.000832). (e) GEPIA2 correlation analysis showed a positive Pearson correlation coefficient between CEACAM6 and NOX4 (p = 7.3e-05, R = 0.19). (f) Immunofluorescence micrographs of human gastritis biopsy tissue sample showing the status of HIF1α (green), CEACAM6 (red), and NOX4 (red) (n = 3). (g) Human met- astatic GC biopsy tissue and their paired normal tissues (n = 3) showing enhanced expression of HIF1α (green), CEACAM6 (red), and NOX4 (red) in GC samples. Nuclei were stained for DAPI (blue). Graphical representation showing significant changes in the levels of HIF1α, CEACAM6, and NOX4 are present in Figure S3. Tissues were sectioned at 5 μm thickness. Images were captured using 20× objective and scale bars = 50 μm. In panel c, *indicates significance.

Article Snippet: Human CEACAM6- pdKCR- neo construct, pCMV6- Xl5- HIF1α (Origene Technologies, MD, USA), human NOX4 (courtesy: Karl- Heinz Krause, Addgene plasmid #69352) overexpression plasmids and empty vectors were used in this study [36, 37].

Techniques: Immunofluorescence, Microscopy, Fluorescence, Gene Expression, Expressing, Staining

Journal: Cancer medicine

Article Title: Hypoxia and Hypoxia-Reoxygenation Potentiate Helicobacter pylori Infection and Gastric Epithelial Cell Proliferation.

doi: 10.1002/cam4.70860

Figure Lengend Snippet: FIGURE 7 | CEACAM6-expressing GECs activate the CEACAM6-NOX4 cascade, upregulate ROS generation, and gain significantly more prolif- erative ability after being exposed to hypoxia-reoxygenation and H. pylori infection. (a) Western blot analysis showed that levels of CagA, CEACAM6, and NOX4 were significantly increased (graphical representations are shown in Figure S7a–c) in AGS cells upon CEACAM6 stable overexpres- sion and hypoxia-reoxygenation before infection with H. pylori. (b) Fluorescence micrographs and graphical data (n = 3) demonstrated enhanced ROS production in hypoxia and reoxygenation-exposed and H. pylori-infected CEACAM6 overexpressing AGS cells when compared with the empty vector-expressing stable cells with similar treatments. For ROS detection, cells were incubated with 1 μM DCFDA for 1 h after infection. Nuclei were stained with DAPI. (c) Graphical representation of cellular proliferation assessed by MTT assay (n = 3) showed significantly increased proliferation of H. pylori-infected cells with CEACAM6 overexpression as well as hypoxia-reoxygenation when compared with the empty vector-expressing as well as normoxia-exposed cells. Objective used—60×, scale bars representing 25 μm. Graphs = mean ± SEM. Statistical significance was determined using two-way ANOVA followed by Tukey's post hoc analysis (n = 3). *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. In the Figure, Hp = H. pylori. (d) The summary figure depicting the regulation of ROS signaling events in H. pylori-infected normoxic and hypoxic GECs. H. pylori infection of GECs leads to the accumulation of HIF1α in normoxia, but the effect is far more enhanced in hypoxic cells due to the increased level of HIF1 and HIF1-driven CEACAM6 upregulation. CEACAM6 facilitates H. pylori adhesion and upregulates ROS via enhanced NOX4 generation. Enhanced HIF1-CEACAM6-NOX4 signaling has a proliferative effect on GECs. Numbers indicate the sequence of events.

Article Snippet: Human CEACAM6- pdKCR- neo construct, pCMV6- Xl5- HIF1α (Origene Technologies, MD, USA), human NOX4 (courtesy: Karl- Heinz Krause, Addgene plasmid #69352) overexpression plasmids and empty vectors were used in this study [36, 37].

Techniques: Expressing, Infection, Western Blot, Fluorescence, Plasmid Preparation, Incubation, Staining, MTT Assay, Over Expression, Sequencing

Journal: Cellular microbiology

Article Title: The hepatitis E virus ORF3 protein stabilizes HIF-1alpha and enhances HIF-1-mediated transcriptional activity through p300/CBP.

doi: 10.1111/j.1462-5822.2009.01340.x

Figure Lengend Snippet: Fig. 2. HIF-1 mediates the ORF3-dependent upregulation of glycolytic pathway genes. Control and ORF3-expressing stable cell lines were transfected with either a HIF-1a dominant-negative expression construct (left panels) or a validated pool of HIF-1a siRNAs (right panels), as described in Experimental procedures. The RNA prepared from these cells was then subjected to RT-PCR using primers specific for various genes. Histone H4 was used as the loading control and HIF-1a to demonstrate the siRNA efficacy.

Article Snippet: The antibodies to hexokinase I and II, ERK1 (K23), actin, HIF-1a, p300, GAPDH and the HRP-conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Control, Expressing, Stable Transfection, Transfection, Dominant Negative Mutation, Construct, Reverse Transcription Polymerase Chain Reaction

Journal: Cellular microbiology

Article Title: The hepatitis E virus ORF3 protein stabilizes HIF-1alpha and enhances HIF-1-mediated transcriptional activity through p300/CBP.

doi: 10.1111/j.1462-5822.2009.01340.x

Figure Lengend Snippet: Fig. 3. Post-transcriptional stabilization of HIF-1a. A. The RT-PCR (left panels) and Western blotting (right panels) analyses were carried out to estimate transcriptional activation of the HIF-1a gene and the equilibrium levels of the HIF-1a protein, respectively, in stable cell lines or transfected Huh7 cells. In both assays, ORF3 was used as an expression control; the loading controls were Histone H4 and ERK1 for RT-PCR and Western blotting respectively. B. Huh-7 cells were co-transfected with the plasmids pORF3–EGFP (+) or pEGFPN1 (–) and p110DN (or pSGI as control) as described. At 36 h post transfection, the cells were treated with either 50 mM LY294002 or an equal volume of DMSO for 12 h. Cell lysates were prepared and Western blotting was performed for HIF-1a, pAkt, Akt, p110DN (anti-HA), ERK, ORF3–EGFP and EGFP as described in Experimental procedures. ERK and ORF3–EGFP (or EGFP) served as loading and expression controls respectively. C. Huh7 cells were co-transfected with HRE-Luc reporter plasmid and either pORF3–EGFP or pEGFP-N1 (vector control). At 36 h post transfection, the cells were treated with either 50 mM LY294002 or an equal volume of DMSO (control) for 12 h. Cell lysates containing equal amounts of total protein were quantified for luciferase activity. The results shown are representative of three independent experiments, each with triplicate samples.

Article Snippet: The antibodies to hexokinase I and II, ERK1 (K23), actin, HIF-1a, p300, GAPDH and the HRP-conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Reverse Transcription Polymerase Chain Reaction, Western Blot, Activation Assay, Stable Transfection, Transfection, Expressing, Control, Plasmid Preparation, Luciferase, Activity Assay

Journal: Cellular microbiology

Article Title: The hepatitis E virus ORF3 protein stabilizes HIF-1alpha and enhances HIF-1-mediated transcriptional activity through p300/CBP.

doi: 10.1111/j.1462-5822.2009.01340.x

Figure Lengend Snippet: Fig. 4. The ORF3 protein enhances HIF-1a DNA binding and transcriptional activities. A. The pCN and ORF3/4 cells were left untreated or treated with either 100 mM CoCl2 for 5 h or with 100 ng ml-1 EGF for 30 min. Nuclear lysates were prepared and electrophoretic mobility shift assays were carried out as described in Experimental procedures. A mutant probe (mHIF-1) was used to confirm specific binding. The arrow indicates the specific protein-DNA complex. Lanes: 1, HIF-1 probe only; 2, mutant HIF-1 probe only; 3, pCN lysate with HIF-1 probe; 4, ORF3/4 lysates with HIF-1 probe; 5, EGF-stimulated pCN lysate with HIF-1 probe; 6, EGF-stimulated ORF3/4 lysate with HIF-1 probe; 7, CoCl2-treated pCN lysate with HIF-1 probe; 8, CoCl2-treated ORF3/4 lysate with HIF-1 probe; 9, pCN lysate with mutant HIF-1 probe; 10, ORF3/4 lysate with mutant HIF-1 probe. B. Schematic illustration of expression vectors used in the study. The pEGFP-N1 (Clontech) was used to create in-frame fusions between orf3 and egfp for expression of an ORF3–EGFP fusion protein. Deletions of various ORF3 domains (X) were created as described in Experimental procedures. C. Huh7 cells were co-transfected with HRE-Luc reporter plasmid and one of the indicated plasmids. Cell lysates containing equal amounts of total protein were quantified for luciferase activity. The results shown are representative of three independent experiments, each with triplicate samples. A Western blot with anti-EGFP is also shown to indicate comparable expression levels of the different proteins.

Article Snippet: The antibodies to hexokinase I and II, ERK1 (K23), actin, HIF-1a, p300, GAPDH and the HRP-conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Binding Assay, Electrophoretic Mobility Shift Assay, Mutagenesis, Expressing, Transfection, Plasmid Preparation, Luciferase, Activity Assay, Western Blot

Journal: Cellular microbiology

Article Title: The hepatitis E virus ORF3 protein stabilizes HIF-1alpha and enhances HIF-1-mediated transcriptional activity through p300/CBP.

doi: 10.1111/j.1462-5822.2009.01340.x

Figure Lengend Snippet: Fig. 5. The HIF-1a C-terminal activation domain is active in ORF3-expressing cells. The pCN and ORF3/4 cells were co-transfected with the pG4.Ha786–826 expression vector and the pG5E1bLUC reporter vector. Plasmid pG4.Ha786–826 expresses the C-terminal activation domain (aa 786–826) of HIF-1a (HIF-CAD) fused with the DNA binding domain of the yeast transcription factor GAL4. The reporter plasmid pG5E1bLUC expresses the firefly luciferase gene under control of the minimal E1B TATA promoter driven by five GAL4 binding sites. The transfected cells were either left untreated or treated with 100 mM CoCl2 for 5 h prior to lysate preparation and luciferase assay. The results shown are representative of three independent experiments, each with triplicate samples.

Article Snippet: The antibodies to hexokinase I and II, ERK1 (K23), actin, HIF-1a, p300, GAPDH and the HRP-conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Techniques: Activation Assay, Expressing, Transfection, Plasmid Preparation, Binding Assay, Luciferase, Control

Journal: Molecular Cancer Research

Article Title: A Hypoxia-Inducible HIF1–GAL3ST1-Sulfatide Axis Enhances ccRCC Immune Evasion via Increased Tumor Cell–Platelet Binding

doi: 10.1158/1541-7786.mcr-19-0461

Figure Lengend Snippet: Figure 2. GAL3ST1 is a HIF target gene. A, GAL3ST1 and GLUT1 mRNA from 786 or RCC4-MOCK and -VHL cells was quantified using qRT-PCR. B, 786 cells stably expressing empty MOCK plasmid, WT HA-VHL, HA-VHL (C162F), and HA-VHL (L188V) were lysed and immunoblotted with the indicated antibodies. C, 786 and RCC4-MOCK and -VHL cells were grown in normoxia (21% O2) or hypoxia (1% O2) for 48 hours. GAL3ST1 and GLUT1 mRNA was quantified using qRT-PCR. D, RCC4-MOCK or RCC4-VHL cells were grown for 48 hours in normoxia (21% O2) or hypoxia (1% O2) for 48 hours, then lysed and immunoblotted with the indicated antibodies. E, RCC4-MOCK cells were transfected with siRNA directed to HIF1a or HIF2a. mRNA expression of GAL3ST1 was quantified. Protein expression of HIF1a or HIF2a was quantified to ensure efficient knockdown was achieved. F, The GAL3ST1 promoter sequence containing two putative HREs (HRE1 and HRE2). HRE1 is approximately 800 bp upstream of HRE2. G, HEK293A cells were transfected with (þ) or without () HA-HIF1a (P>A) and/or HA-HIF2a (P>A) in combination with the indicated luciferase vectors. Cells were lysed and a luciferase assay was performed; luciferase activity was normalized to protein content (RLU/mg). Lysates were also immunoblotted with the indicated antibodies to verify equivalent HA-HIFa (P>A) expression. Western blots are aligned with the line graph below to signify the particular luciferase construct coexpressed with MOCK and HA-HIFa (P>A) plasmids. Experiments were performed in triplicate. (Continued on the following page.)

Article Snippet: Anti-HIF2a and anti-HIF1a (H1alpha67) antibodies were obtained from Novus Biologicals.

Techniques: Quantitative RT-PCR, Stable Transfection, Expressing, Plasmid Preparation, Transfection, Knockdown, Sequencing, Luciferase, Activity Assay, Western Blot, Construct

Journal: Nature Immunology

Article Title: The astrocyte-produced growth factor HB-EGF limits autoimmune CNS pathology

doi: 10.1038/s41590-024-01756-6

Figure Lengend Snippet: a , RT–qPCR analysis of Hbegf expression by ACSA2 + astrocytes following i.c.v. injection of TNF-α and IL-1β or vehicle. n = 3 per group. b , RT–qPCR analysis of Hbegf expression by primary mouse astrocytes over 24 h following stimulation with TNF-α and IL-1β or vehicle. Unstimulated controls (timepoint 0) were used as reference. n = 4 per timepoint. c , Relative expression (% of parent) of HB-EGF by primary mouse astrocytes following stimulation with TNF-α and IL-1β or vehicle, quantified by intracellular flow cytometry. n = 3 per group. d , Representative example of a predicted Arnt::Hif1a-binding site in the Hbegf promoter identified by JASPAR . e , RT–qPCR analysis of Hbegf expression by primary mouse astrocytes stimulated with CoCl 2 over 24 h. n = 4 per timepoint. f , Intracellular flow cytometric analysis of HB-EGF expression by primary mouse astrocytes under pseudohypoxic conditions (CoCl 2 ) for 24 h. n = 3 per group. g , Schematic depicting the HBEGF luciferase promoter–reporter construct, where activation of the HBEGF promoter drives the expression of a Gaussia luciferase. h, HBEGF promoter activity in HEK293T cells co-transfected with an HBEGF promoter activity reporter construct and a stably active HIF1α (pHIF1a, n = 6) or control vector ( n = 2). i, HBEGF promoter activity in HEK293T cells following stimulation with TNF-α and IL-1β, or CoCl 2 , over 24 h. n = 5 per group and timepoint. j , RT–qPCR analysis of Hbegf expression in primary mouse astrocytes following stimulation with CoCl 2 , I3S, CH-223191 or a combination. n = 3–7 per group. k , Flow cytometric quantification of HB-EGF expression in primary mouse astrocytes (ACSA2 + GFP + ) transduced with a control ( Gfap::Scrmbl ), AhR ( Gfap::Ahr ), HIF1α ( Gfap::Hif1 ) or HB-EGF ( Gfap::Hbegf ) targeting CRISPR–Cas9 vector, quantified by intracellular flow cytometry. n = 3 per group. l , Relative expression (% of parent) of HB-EGF by astrocytes in Gfap::Scrmbl ( n = 5), Gfap::Hif1a ( n = 3) and Gfap::Ahr ( n = 3) mice quantified by intracellular flow cytometry. m , UMAP plot of CNS cells from mice with EAE; data were obtained from Wheeler et al. . MG, microglia; Mac, macrophages; Endo, endothelial cells; Oligo, oligodendrocytes. n , NicheNet circle plot depicting ligand–target genes in CNS cells from EAE mice. o , GO enrichment analysis (Biological Process) of Hbegf target genes. p , PANTHER Protein class analysis of Hbegf target genes. q , Enrichment analysis (Descartes Cell Types and Tissue 2021) of Hbegf target genes. r , s , Schematic ( r ) and RT–qPCR analysis ( s ) of Nos2 , Csf2 and Bdnf expression in microglia stimulated with ACM from primary mouse astrocytes activated with TNF-α, IL-1β ± HB-EGF. n = 3 per group. Astrocytes were stimulated for 24 h and extensively washed before the addition of fresh medium and collection of ACM 24 h later. t , u , Schematic ( t ) and RT–qPCR analysis ( u ) of Nos2 , Ccl2 and Bdnf expression in astrocytes stimulated with microglia-conditioned medium (MGCM) from primary mouse microglia activated with LPS ± HB-EGF. n = 3 per group. Microglia were stimulated for 24 h and extensively washed before the addition of fresh medium and collection of MGCM 24 h later. Data are shown as mean ± s.d. if not indicated otherwise. Unpaired t -test in a , c , f and h ; one-way ANOVA with Dunnett’s multiple comparisons test (tested against control) in b , e , j , k , l , s and u ; two-way ANOVA with Sidak’s multiple comparisons test in i .

Article Snippet: The following TaqMan probes were used: Actb (Mm02619580_g1), Ahr (Mm00478932_m1), Bdnf (Mm04230607_s1), Ccl2 (Mm00441242_m1), Csf2 (Mm01290062_m1), Cd68 (Mm03047343_m1), Dnmt1 (Mm01151063_m1), Dnmt3a (Mm00432881_m1), Dnmt3b (Mm01240113_m1), Gapdh (Mm99999915_g1), Il1b (Mm00434228_m1), Icam1 (Mm00516023_m1), Ldha (Mm01612132_g1), Lif (Mm00434762_g1), Hbegf (Mm00439306_m1), HBEGF (Hs00181813_m1), Hif1a (Mm00468869_m1), Mbp (Mm01266402_m1), Nos2 (Mm00440502_m1), Ptprz1 (Mm00478484_m1), Pdgfra (Mm00440701_m1), Plp (Mm01297209_m1), Tnf (Mm00443258_m1), Trdmt1 (Mm00438511_m1). qPCR data were analyzed by the delta-delta CT (ΔΔCt) method.

Techniques: Quantitative RT-PCR, Expressing, Injection, Flow Cytometry, Binding Assay, Luciferase, Construct, Activation Assay, Activity Assay, Transfection, Stable Transfection, Control, Plasmid Preparation, Transduction, CRISPR

Journal: Nature Immunology

Article Title: The astrocyte-produced growth factor HB-EGF limits autoimmune CNS pathology

doi: 10.1038/s41590-024-01756-6

Figure Lengend Snippet: a , schematic of binding domains, flow cytometric quantification, and representative histograms of membranous HB-EGF (antibody 1) and cytoplasmatic HB-EGF (antibody 2) in astrocytes in response to stimulation with TNF-α and IL-1β over 48 hours. n = 4 per timepoint. b , RT-qPCR analysis of Hbegf expression and quantification of soluble HB-EGF (sHB-EGF) in the supernatant of primary mouse astrocyte in response to stimulation with TNF-α and IL-1β over 48 hours. n = 4 per timepoint. d , schematic of stimulation and supernatant sampling, as well as quantification of sHB-EGF ( e ) in primary mouse astrocytes stimulated with TNF-α and IL-1β for 8 hours, followed by extensive washing before supernatant sampling. n = 4/6 per timepoint. f , RT-qPCR analysis of Hif1a expression by ACSA2 + astrocytes following i.c.v. injection of TNF-α and IL-1β or vehicle. n = 3 per group. g , RT-qPCR analysis of Ldha and Ero1l expression as positive controls for HIF1α related signaling in primary mouse astrocytes stimulated with CoCl 2 over 24 hours. n = 4 per timepoint. h , RT-qPCR analysis of HBEGF expression by human astrocytes under pseudohypoxic conditions (CoCl2). n = 2 per group. i , and Enzyme-linked Immunosorbent Assay (ELISA) of soluble HB-EGF (sHB-EGF) in the supernatant of primary mouse astrocytes under pseudohypoxic conditions (CoCl2). n = 4/16 per group. j , schematic of transcriptional competition between HIF1α and AhR. k , representative scatterplots of HB-EGF expression in primary mouse astrocytes (ACSA2 + GFP+) transduced with a control (Gfap::Scrmbl), AhR (Gfap::Ahr), HIF1α (Gfap::Hif1), or HB-EGF (Gfap::Hbegf) targeting CRISPR/Cas9 vector, quantified by intracellular flow cytometry. n = 3 per group. l , representative histograms depicting HB-EGF staining in astrocytes obtained from Gfap::Scrmbl , Gfap::Ahr and Gfap::Hif1a mice during late-stage EAE. m , RT-qPCR analysis of Hbegf, Ahr, Hif1a, and Ldha in ACSA2+ astrocytes in Gfap::Scrmbl , Gfap::Hif1a , and Gfap::Ahr mice. n = 3 per group. Data shown as mean ± SD. One-way ANOVA with Dunett’s multiple comparisons test (tested against control) in ( a , b , c , e , m ), unpaired t -test in ( f , i ), Two-way ANOVA with Sidak’s multiple comparisons test in ( g ).

Article Snippet: The following TaqMan probes were used: Actb (Mm02619580_g1), Ahr (Mm00478932_m1), Bdnf (Mm04230607_s1), Ccl2 (Mm00441242_m1), Csf2 (Mm01290062_m1), Cd68 (Mm03047343_m1), Dnmt1 (Mm01151063_m1), Dnmt3a (Mm00432881_m1), Dnmt3b (Mm01240113_m1), Gapdh (Mm99999915_g1), Il1b (Mm00434228_m1), Icam1 (Mm00516023_m1), Ldha (Mm01612132_g1), Lif (Mm00434762_g1), Hbegf (Mm00439306_m1), HBEGF (Hs00181813_m1), Hif1a (Mm00468869_m1), Mbp (Mm01266402_m1), Nos2 (Mm00440502_m1), Ptprz1 (Mm00478484_m1), Pdgfra (Mm00440701_m1), Plp (Mm01297209_m1), Tnf (Mm00443258_m1), Trdmt1 (Mm00438511_m1). qPCR data were analyzed by the delta-delta CT (ΔΔCt) method.

Techniques: Binding Assay, Quantitative RT-PCR, Expressing, Sampling, Injection, Enzyme-linked Immunosorbent Assay, Transduction, Control, CRISPR, Plasmid Preparation, Flow Cytometry, Staining

Journal: Nature Communications

Article Title: Transcriptional signature in microglia associated with Aβ plaque phagocytosis

doi: 10.1038/s41467-021-23111-1

Figure Lengend Snippet: a Representative 3D reconstructions of confocal z -stacks showing PSD95 internalized within WT, 5xFAD XO4 − or 5xFAD XO4 + microglia cells (scale bars = 15 μm). b PSD95 within microglia quantified as the average volume of phagocytosed PSD95 volume per microglia volume in each dentate gyrus section ( n = 6 z -stacks per condition; * p = 0.0057, using one-way ANOVA and Tukey’s multiple comparison test). All data are from n = 3 WT and n = 6 5xFAD animals and is presented as mean ± SEM per individual section. c Functional analysis of ex vivo mouse microglia phagocytosis following 1 h incubation with ( c i ) pHrodo-green-labelled E. coli , ( c ii ) pHrodo-red-labelled synaptosomes or ( c iii ) pHrodo-green-labelled fAβ by FACS. Each population is gated based on XO4 + signal and compared to controls not incubated with pHrodo particles. d i Quantitation of the percentage of XO4 + and XO4 − microglia that phagocytose pHrodo-red-labelled synaptosomes or pHrodo-green-labelled E. coli (comparing XO4 − and XO4 + microglia from n = 4 animals), or d ii pHrodo-green-labelled fAβ (comparing XO4 − and XO4 + microglia from n = 3 animals). Data in ( d ) are presented as mean ± SEM. * p = 0.0233, ** p = 0.0027 and **** p = 9.2 × 10 −7 by paired 2-tailed t -test. e SCENIC regulon analysis showing that Hif1a and Elf3 are predicted to control the XO4 + gene regulatory network. The number of genes in each regulon is shown in parentheses. f , g BV2 cells were stably transduced with mCherry or mCherry. shHif1a lentivirus and treated with DMSO or AF488-labelled fAβ for 24 h, then blue-labelled synaptosomes for 1.5 h. mCherry + cells were FACS sorted for AF488-fAβ. f Normalized heatmap of gene expression, measured by qPCR, of signature genes associated with XO4 + microglia in fAβ + and non-treated (un) BV2 cells with or without shHif1a , including Hif1a regulon genes ( Igf1, Spp1, Ctsa, Hif1a ) and genes not part of the Hif1a regulon ( Apoe, Trem2, P2ry12 ). Data are expressed as fold change relative to non-treated mCherry transduced cells, based on ΔCt values relative to Actb . The data are from 3 independent experiments. g The proportion of cells that are highly phagocytic for blue-bead-labelled synaptosomes. Data are expressed as fold change in % phagocytosis relative to non-treated mCherry transduced cells (mean ± SEM). The data are from 3 independent experiments performed in triplicate. n.s., p = 0.22, ** p = 0.0026, **** p = 6.0 × 10 −6 by two-way ANOVA using Tukey’s multiple comparison test. h Histograms showing fluorescence intensity of HIF1A intracellular staining in AF488-fAβ + and non-treated BV2 cells. Secondary antibody control cells are stained with Pacific-blue-labelled secondary antibodies alone. i The proportion of dox-treated (or not) and fAβ + or non-treated (un) BV2 cells transduced with dox-inducible Hif1a expression constructs that are highly phagocytic for blue-bead-labelled synaptosomes. Data are expressed as fold change in % phagocytosis relative to non-treated mCherry transduced cells (mean ± SEM). The data are from 3 independent experiments performed in triplicate. * p = 0.0253 by one-way ANOVA using Holm-Sidak’s multiple comparison test.

Article Snippet: Plots were generated using the ggplot2 function in R. For validation of HIF1A regulon in human ES-derived iMGLs or the mouse BV2 microglial cell line, 400 ng RNA was reverse transcribed using SuperScriptTM II Reverse Transcriptase (Thermo Fisher Scientific, #18064014). qPCR was performed using TaqMan assays ( SPP1 , Hs00959010_m1; HIF1A , Hs00153153_m1; GAPDH , Hs02758991_g1; APOE , Hs00171168_m1; TREM2 , Hs00219132_m1; CX3CR1 , Hs01922583_s1; housekeeping gene SNRPD3 , Hs00188207_m1, mouse TaqMan assays Apoe , Mm00437573_m1; Spp1 , Mm00436767_m1; Trem2 , Mm04209424_g1; Ctsa , Mm00447197_m1; Igf1 , Mm00439560_m1; P2ry12 , mM00446026_M1; Hif1a , Mm00468869_m1; Actb , Mm00607939_s1; Tyrobp , Mm00449152_m1) in a Roche LightCycler ® 480 (Roche).

Techniques: Comparison, Functional Assay, Ex Vivo, Incubation, Quantitation Assay, Control, Stable Transfection, Transduction, Gene Expression, Fluorescence, Staining, Expressing, Construct

Journal: Nature Communications

Article Title: Transcriptional signature in microglia associated with Aβ plaque phagocytosis

doi: 10.1038/s41467-021-23111-1

Figure Lengend Snippet: a Top ten activators of the Hif1a regulon predicted by IPA. The activation z -score is a statistical measure of the match between the expected relationship direction of regulation and the observed gene expression; positive z -scores are indicative of predicted activation. p -Value of overlap refers to the significance of the overlap between the Hif1a regulon gene set and the regulated target genes predicted by IPA. The 3 predicted regulators tested in this figure are in bold. b Cartoon diagram of hypothesis generated by IPA. c Stimulation of iMGLs with MyD88-dependent TLR-agonist Pam3csk (alone or with BMP9) induces genes associated with XO4 + microglia within the Hif1a regulon as identified by qPCR ( HIF1A ** p = 0.0014 and p = 0.0012, respectively, SPP1 *** p = 0.00024 and ** p = 0.0015 by one-way ANOVA and Holm-Sidak post-test), n = 3 independent experiments. d Cytometric bead array ( **** p < 0.0001 by one-way ANOVA and Holm-Sidak post-test, CCL3: F(5,18)=137.1; CCL4: F(5,18)=42.04), n = 4 independent experiments. MyD88-independent TLR stimulation (Poly:IC) does not shift iMGLs towards a gene expression signature associated with XO4 + microglia . Data are fold changes normalized to non-treated cells. e MyD88-dependent expression of genes associated with XO4 + microglia is modulated by rapamycin. Data are fold changes induced by rapamycin normalized to each respective treatment in the absence of rapamycin. HIF1A **** p = 3.5 × 10 −7 and 1.7 × 10 −7 and SPP1 **** p = 6.5 × 10 −5 and *** p = 0.0006, respectively, by two-way ANOVA compared to non-rapamycin-treated cells and Holm-Sidak post-test. n = 3 independent experiments. f Venn diagram showing the overlap between a XO4 + -like state induced in iMGLs using Pam3csk and reversed by rapamycin (RNA-seq, n = 4 independent experiments) as predicted by ingenuity pathway analysis (IPA) with the mouse gene expression signature associated with XO4 + microglia , as measured by RNA-seq ( p = 3.17 × 10 −20 , hypergeometric test). g Representative gene expression heatmap of selected genes that are part of the overlap, showing expression levels in mice (WT, 5xFAD XO4 − , 5xFAD XO4 + ) and human iMGLs (non-treated, Pam3csk and Pam3csk+rapamycin). h Fluorescently labelled synaptosome internalization by iMGLs treated with amyloid fibrils, alone, or in combination with rapamycin for 48 h, as measured by FACS. The data are presented as mean ± SEM, and p = 0.0002 by unpaired t -test, n = 3 independent experiments. i Proposed model of generation and regulation of microglia diversity in AD, created with BioRender.com.

Article Snippet: Plots were generated using the ggplot2 function in R. For validation of HIF1A regulon in human ES-derived iMGLs or the mouse BV2 microglial cell line, 400 ng RNA was reverse transcribed using SuperScriptTM II Reverse Transcriptase (Thermo Fisher Scientific, #18064014). qPCR was performed using TaqMan assays ( SPP1 , Hs00959010_m1; HIF1A , Hs00153153_m1; GAPDH , Hs02758991_g1; APOE , Hs00171168_m1; TREM2 , Hs00219132_m1; CX3CR1 , Hs01922583_s1; housekeeping gene SNRPD3 , Hs00188207_m1, mouse TaqMan assays Apoe , Mm00437573_m1; Spp1 , Mm00436767_m1; Trem2 , Mm04209424_g1; Ctsa , Mm00447197_m1; Igf1 , Mm00439560_m1; P2ry12 , mM00446026_M1; Hif1a , Mm00468869_m1; Actb , Mm00607939_s1; Tyrobp , Mm00449152_m1) in a Roche LightCycler ® 480 (Roche).

Techniques: Activation Assay, Gene Expression, Generated, Expressing, RNA Sequencing